国立研究開発法人 国際農林水産業研究センター | JIRCAS

Yam Variety Identification Toolkit:Step 1

Yam Variety Indentification ToolKit
About ToolKit Minimum SSR Marker Finder Inquiry form

Step 1

Step 1: Identify all yam genotypes and nominate minimum set of SSR markers which can differentiate all your genotypes.

 

In this step, you will determine the most suitable SSR marker sets for your variety identification by:

  • Listing all potential Guinea yam varieties/lines in your premises which might mechanically mix with each other.
  • Nominating potential SSR marker sets (usually consist of 1 - 3 markers) using the web-application “Minimum SSR Marker Finder for Guinea Yam”.
  • Determining the best-bet marker set for analysis.

What is the minimum set of SSR markers?

Do you need all data?
Though currently, 16 SSR markers are available for Guinea yam, you may only need a few markers to distinguish the varieties/lines you have.

 

Among the varieties/lines that potentially cause mechanical mixture in your premises/fields, only a few SSR markers (usually 1 - 3 markers) can identify each genotype. The “Minimum SSR Marker Finder for Guinea Yam” is a web-application especially designed to find a minimum set (usually 1 ~ 3 markers) of SSR markers for Guinea yam. This application can assist you to nominate several options of potential SSR marker sets, which can distinguish all varieties/lines you select in a few seconds instead of working on an Excel spreadsheet by your self.

How I can benefit from this web-application?

Using a minimum set of SSR markers (usually 1 - 3 markers), you can potentially, reduce the cost and time up to 1/10 of cases using all 16 SSR markers. Since PCR and gel electrophoresis processes are most time-consuming steps for variety identification using SSR markers, it drastically saves you time and money.

How to use the web-application

To nominate a minimum SSR marker set using “Minimum SSR Marker Finder for Guinea Yam”, only 4 processes are required:

  1. Agree with our “Terms of use”
  2. Nominate the varieties/lines potentially cause mechanical mixture in your premises/fields
  3. Click “Analysis”
  4. Select ideal SSR marker set for your variety identification

To get started with the “Minimum SSR Marker Finder for Guinea Yam”, please click here.

                             

Go to “Minimum SSR Marker Finder for Guinea Yam”

 

For more detailed instruction, please click here or select “User Manual” tab on top of this site.

                             

Go to Manual for Marker finder

Limitations

The “Minimum SSR Marker Finder for Guinea Yam” is designed for your variety identification of Guinea yam, but has some limitations:

 

Case 1: Your materials may not be on the database

The “Minimum SSR Marker Finder for Guinea Yam” requires SSR polymorphism data to be registered in the “Guinea Yam SSR Polymorphism Database”. Currently this database contains the data of approximately 550 genotypes (@Feb 2020) including IITA Genetic Resources Center (GRC) materials, IITA and NARS breeding lines, and local varieties, and we welcome new SSR polymorphism datasets of new genotypes. 

We will be able to assist you for SSR polymorphism analysis in free of charge, till thee closure of EDITS-Yam project in 2021 March. If you have interest, please feel free to communicate with us via our inquiry form. 

 

Case 2: Selection is limited up to 30 varieties/lines

In this web-application, the number of varieties/lines you can select are limited to “up to 30”. This is simply to avoid web-server overload from heavy calculations. If you have more than 30 varieties/lines to be separated, we recommend you consider using the “Minimal Marker” , Perl-based software developed by “Institute of Fruit Tree and Tea Science, NARO (NIFTS, Japan)”.The software can handle large datasets of more than 30 varieties/lines. If you need SSR polymorphism data for this software, please contact us via our inquiry form.

 

Case 3: No SSR marker set was nominated for your selected varieties/lines

If some of your selected varieties/lines show the exact same polymorphism pattern for all 16 SSR markers available, this “Minimum SSR Marker Finder for Guinea Yam” will not be able to propose a minimum set of SSR markers. This problem may be caused, when:

Case 3-1 "the resolution of 16 SSR marker currently available is not enough to discriminate all materials"
                                        or
Case 3-2  "simply the same variety/line is registered with different names in our database ". 

Currently we have no solution for these two possibilities. However, especially in case 3-2, you can use the list of materials that show the same SSR polymorphism pattern to adjust your selection of varieties/lines. If you need our support, please contact us via our inquiry form.

Tips to select the best-bet marker set

The “Minimum SSR Marker Finder for Guinea Yam” can only nominate all suitable SSR marker sets for your selected varieties/lines. Theoretically, any marker sets nominated can be used for your variety identification. However, please understand that you only need one best-bet marker set, though more than 20 marker sets can be nominated.

Here are some tips for you to select the best-bet SSR markers. Please check the tips below and select your best marker set among the nominated marker sets.

Tips

  • If you have any primers of SSR markers for Guinea yam, select the set that includes the marker(s) you have to reduce the cost.
  • Please see "Supplement 1", which indicates the alleles found among 447 Dr accessions by SSR markers for your selection:
    • Some markers show large allele size and may require relatively longer loading time for gel electrophoresis.
    • Some markers which show larger gaps between allele size may contribute to have better resolution of gel image.
    • Some markers with a few alleles may not have wide adaptation for other varieties/lines.

To open suppliment flile iin PDF, please click below link.

Supplement document
PDF iconThe alleles found among 447 Dr accessions by SSR markers for your selection Supplement 1.pdf

Primer information

Once you choose best-bet marker set, please use below inforrmation for your purchase of primer which will be used in Step 3 "Conduct PCR with nominated markers in step 2, and gel electrophoresis". 

Marker Primer Sequence (5' to 3')

 Expected size

YM7 F AGCATTGGGTCCTTTCATCC 203
R ACAATTCACACAAAGCATGGC
YM8 F TCTTAGGCTTTGGGCAGGG 166
R AGTATGCCTACCCTGTTCTTC

YM16

F TGAAGAGAATGTTGAGATCGTACC 150
R TATCCGGCCCTCTCATTGG
YM18 F GACATTGGGGATCTCTTATCAT 266
R TAGCAGCAGTAACGTTAAGGAA
YM25 F GATGGAGATGAGGAGGCCG 237
R TTCGAAGCCAGAGCAAGTG
YM27 F TCCAGCTCTTTAGCACAGG 231
R AGGAGCATAGGCAACAAGC
YM28 F CCATTCCTATTTAAGTTCCCCT

333

R GATGAAGAAGAAGGTGATGATG
YM30 F CCACAACTAAAAACACATGGAC 212
R GTGGTAGGGTGTGTAGCTTCTT
YM31 F AAGCCTAGTCGATGGGTGG 221
R TGCTGTTCCAACTTCCAAGC
YM43 F GCCTTGTTTTGTTGATGCTTCG 178
R CCAGCCCACTAATCCCTCC
YM44 F CGCAACCAGCAAAGGATTTA 156
R ATTCTGTCTCTCAAAACCCCT
YM49 F TGGGGTGAGAGAGTAAGTGG 163
R TCACCGGGGATCTTCTTGC
YM50 F TTGCCCTTGGGATGTAGGG 234
R CATCCCCGTTGTATCCTGC
YM54 F CACTTGCTCTCTCATCGGC 162
R TTGACAACCTCTATTTTGCCC
YM61 F AGTGGTGCTGTAGTAACTGGAA 252
R CATGACTACCTTTCCTCAATCA
YM69 F CTCTCTACCTCCCAACAAAAAC 229
R AATCTTGCACCACCTTTTCTAC

To open in PDF fle, please click below link.

Supplement document
PDF iconSSR Primer information for white Guinea yam SSR primer information

Ready?

If you have identified the best marker set, let us move to Step2.

Go to Step 2

 

Quick link